• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention provides variants of a polX family DNA polymerase capable of synthesizing a template-free nucleic acid molecule, or a functional fragment thereof, comprising at least one mutation of a at least one particular position, and uses of these variants, in particular for the synthesis of nucleic acid molecules comprising 3'-OH modified nucleotides.
    公开号:FR3053699A1
    申请号:FR1756408
    申请日:2017-07-07
    公开日:2018-01-12
    发明作者:Thomas Ybert；Marc Delarue
    申请人:Institut Pasteur de Lille；DNA Script SAS；
    IPC主号:
    专利说明:

    © Publication number:
    (to be used only for reproduction orders)
    ©) National registration number ® FRENCH REPUBLIC
    NATIONAL INSTITUTE OF INDUSTRIAL PROPERTY
    053 699
    56408
    COURBEVOIE © Int Cl 8 : C 12 N 9/12 (2017.01), C12N 15/63, 15/54, C12P 19/34, C 12 Q 1/68
    A1 PATENT APPLICATION
    ©) Date of filing: 07.07.17. (© Applicant (s): DNA SCPIPT Joint stock company (© Priority: folded — TR and INSTITUT PASTEUR - FR. @ Inventor (s): YBERT THOMAS and DELARUE MARC. ©) Date of public availability of the request: 12.01.18 Bulletin 18/02. ©) List of documents cited in the report preliminary research: Refer to end of present booklet (© References to other national documents ©) Holder (s): DNA SCRIPT Société par actions simpli- related: Division requested on 07/07/17 bene- trusted, INSTITUT PASTEUR. of the filing date of 06/14/16 of the initial application no.16 55475. ©) Extension request (s): © Agent (s): CABINET BECKER ET ASSOCIES.
    Υ’Υ VARIANTS OF A POLX FAMILY DNA POLYMERASE.
    The invention relates to variants of a poix family DNA polymerase capable of synthesizing a template strandless nucleic acid molecule, or of a functional fragment of such a polymerase, comprising at least one mutation from a residue to at least one particular position, and uses of these variants, in particular for the synthesis of nucleic acid molecules comprising nucleotides modified into 3'-OH.
    FR 3 053 699 - A1
    i
    Variants of a DNA polymerase of the polX family
    Introduction
    The present invention relates to the field of improving enzymes. The present invention relates to an improved variant of a DNA polymerase of the polX family, a nucleic acid coding for this variant, the production of this variant in a host cell, its use for the synthesis of a nucleic acid molecule without template strand and a kit for the synthesis of a template without template strand nucleic acid.
    The chemical synthesis of nucleic acid fragments is a technique widely used in laboratories (Adams et al., 1983, J. Amer. Chem. Soc. 105: 661; Froehler et al., 1983,
    Tetrahedron Lett. 24: 3171). It makes it possible to quickly obtain nucleic acid molecules comprising the desired nucleotide sequence. In contrast to the enzymes which carry out the synthesis in the 5 ’to 3’ direction, the chemical synthesis is carried out in the 3 ’to 5’ direction. However, chemical synthesis has certain limits. Indeed, it requires the use of multiple solvents and reagents. In addition, it allows only short fragments of nucleic acid to be obtained, which it is then necessary to assemble together to obtain the desired strands of final nucleic acids.
    An alternative solution using enzymes capable of carrying out the coupling reaction between nucleotides from an initial nucleic acid fragment (primer) and in the absence of template strand has been developed. Several enzymes of the polymerase type seem adapted to this kind of synthesis methods.
    There are a very large number of DNA polymerases capable of catalyzing the synthesis of a strand of nucleic acid, in the presence or not of a template strand. Thus, the DNA polymerases of the polX family are involved in a wide range of biological processes, in particular in the mechanisms of DNA repair or correction of errors appearing in DNA sequences. These enzymes are capable of introducing nucleotides into strands of excised nucleic acid following the identification of sequence errors. The DNA polymerases of the polX family group together the DNA polymerases β (Pol β), λ (Pol λ), μ (Pol μ), yeast IV (Pol IV) and the terminal deoxyribonucleotidyl transferase (TdT). The
    TdT in particular is widely used in the processes of enzymatic synthesis of nucleic acid molecules.
    However, these DNA polymerases most often only allow the incorporation of natural nucleotides. In all cases, natural DNA polymerases lose their catalytic activity in the presence of non-natural nucleotides, and in particular nucleotides modified to 3’OH, having a greater steric hindrance than natural nucleotides.
    However, the use of modified nucleotides may prove useful for certain specific applications. It was therefore necessary to develop enzymes capable of catalyzing the synthesis of a strand of nucleic acid by incorporating such nucleotides. DNA polymerase variants have thus been developed, with the aim of functioning with nucleotides comprising significant structural modifications.
    The variants currently available are not entirely satisfactory, in particular because of their low activity, compatible only with enzymatic synthesis on a laboratory scale. There is therefore a need for DNA polymerases capable of synthesizing, if possible on an industrial scale, a nucleic acid in the absence of template strand and using modified nucleotides.
    Summary of the invention
    The present invention removes certain technological obstacles which prevent the industrial use of DNA polymerases for the enzymatic synthesis of nucleic acids.
    The present invention thus provides variants of DNA polymerases of the polX family capable of synthesizing a nucleic acid in the absence of template strand and capable of using modified nucleotides. The variants developed have capacities for incorporating modified nucleotides far superior to those of the natural DNA polymerases from which they are derived. In particular, the DNA polymerase variants which are the subject of the present invention are particularly effective for incorporating nucleotides exhibiting modifications in the sugar level. In fact, the inventors have developed variants with an increased catalytic pocket volume compared to that of the DNA polymerases from which they are derived, favoring the incorporation of modified nucleotides which are more bulky than natural nucleotides. More particularly, the DNA polymerase variants of the polX family which are the subject of the present invention comprise at least one mutation on an amino acid intervening directly at the level of the catalytic cavity of the enzyme, or allowing the contours of this cavity to be deformed in order to to accommodate steric hindrance due to modifications present at the nucleotide level. For example, the mutations introduced allow the enlargement of the catalytic cavity of the enzyme in which the 3'-OH end of the modified nucleotides is housed. Alternatively or additionally, the mutations carried out allow inflation or increase in the volume of the catalytic cavity, increased access to the catalytic pocket by nucleotides modified to 3'-OH and / or confer the flexibility necessary to the structure of the enzyme to allow it to accommodate sterically important modifications of the nucleotides modified to 3'-OH. Thanks to such mutations, once the polymerase is attached to the nucleic acid fragment to be lengthened, the modified nucleotide enters the heart of the catalytic pocket, the access of which is widened and adopts therein an optimal spatial conformation, a phosphodiester bond between the 3'-OH end of the last nucleotide of the nucleic acid strand and the 5'-triphosphate end of the modified nucleotide being created.
    The subject of the invention is therefore a variant of a DNA polymerase of the polX family capable of synthesizing a nucleic acid molecule without a template strand, or a variant of a functional fragment of such a polymerase, said variant comprising at least a mutation of a residue at at least one position selected from the group consisting of M33O, T331, G332, G333,
    F334, K338, H342, D343, V344, D345, F346, A397, D399 D434, V436, A446, L447, L448,
    G449, W450, G452, Q455, F456, E457, R458, R461, N474, E491, D501, Y502, 1503, P505, R508, N509 and A510, or a functionally equivalent residue, the positions indicated being determined by alignment with SEQ ID No. l.
    In a particular embodiment, the variant is capable of synthesizing a strand of DNA or a strand of RNA.
    The present invention relates in particular to a variant of a DNA polymerase of the polX family and in particular of a yeast Pol IV, Pol μ or wild-type TdT, and comprising the selected mutation or mutations. In a particular embodiment, the variant according to the present invention is a variant of the TdT of sequence SEQ ID No. 1 or a homologous sequence which has at least 70%, 80%, 85%, 90%, 95%, 96 %, 97%, 98%, 99% identity with the sequence of SEQ ID No 1, and carries the selected mutation (s).
    The invention also relates to a nucleic acid encoding a variant of a DNA polymerase of the polX family according to the present invention, an expression cassette comprising a nucleic acid according to the present invention and a vector comprising a nucleic acid or a cassette expression according to the present invention. The nucleic acid coding for the variant of the present invention can be that of the mature form or of the precursor form of DNA polymerase according to the present invention.
    The present invention also relates to the use of a nucleic acid, an expression cassette or a vector according to the present invention for transforming or transfecting a host cell. It further relates to a host cell comprising a nucleic acid, an expression cassette or a vector encoding a DNA polymerase of the polX family according to the present invention. It relates to the use of such a nucleic acid, of such an expression cassette, of such a vector or of such a host cell for producing a variant of a DNA polymerase of the polX family according to the present invention. .
    It also relates to a process for producing a variant of a DNA polymerase of the polX family according to the present invention comprising the transformation or the transfection of a host cell with a nucleic acid, an expression cassette or a vector according to the present invention, culturing the transformed / transfected host cell under culture conditions allowing expression of the nucleic acid encoding said variant, and optionally harvesting the variant of a DNA polymerase of the polX family produced by host cell.
    The host cell can be prokaryotic or eukaryotic. In particular, the host cell can be a microorganism, preferably a bacteria, a yeast or a fungus. In one embodiment, the host cell is a bacterium, preferably E. coli. In another embodiment, the host cell is a yeast, preferably P. pastoris or K. lactis. In another embodiment, the host cell is a mammalian cell, preferably a COS7 or CHO cell.
    The invention also relates to the use of a variant of a DNA polymerase of the polX family according to the present invention, for synthesizing a nucleic acid molecule without a template strand, from nucleotides modified to 3′-OH. Of course, the DNA polymerase variant of the polX family according to the present invention can also be used, in the context of the invention, to synthesize a nucleic acid molecule without template strand, from unmodified nucleotides or d '' a mixture of modified and unmodified nucleotides.
    The invention also provides a method for the enzymatic synthesis of a nucleic acid molecule without a template strand, according to which a primer strand is brought into contact with at least one nucleotide, preferably a nucleotide modified to 3'-OH, in the presence of 'a variant of a DNA polymerase of the polX family according to the invention. The implementation of the method can in particular be carried out using a purified variant, a culture medium for a host cell transformed to express said variant, and / or a cell extract from such a host cell.
    The subject of the invention is also a kit for the enzymatic synthesis of a template strandless nucleic acid molecule comprising at least one variant of a DNA polymerase of the polX family according to the invention, nucleotides, preferably modified nucleotides in 3'-OH, and optionally at least one primer strand, or nucleotide primer, and / or a reaction buffer.
    Description of the figures
    Figure 1: SDS-PAGE gel of fractions of a TdT variant according to an exemplary embodiment of the invention (M: Molecular weight marker; 1: Centrifugate before loading; 2: Centrifugat after loading; 3: Wash buffer after loading; 4: Elution fraction 3 mL; 5: Elution fraction 30 mL; 6: Gathering elution peak; 7: Concentration);
    Figure 2: Alignment of amino acid sequences of DNA polymerases Pol μ from Homo sapiens (UniProtKB Q9NP87), Pol μ from Pan troglodytes (UniProtKB H2QUI0), Pol μ from Mus musculus (UniProtKB Q924W4), TdT from Canis lupus familiaris ( UniProtKB F1P657), TdT of Mus musculus (UniProtKB Q3UZ8O), TdT of Gallus gallus (UniProtKB P36195) and TdT of Homo sapiens (UniProtKB P04053) obtained using the Mutalin online alignment software (http: //multalin.toulouse .inra.fr / multalln / multalin.html);
    Figure 3: Comparison of the activity of a truncated wild-type TdT of sequence SEQ ID No. 3 and of several variants of this truncated TdT comprising different substitutions given in Table 1, in the presence of a primer previously radioactively labeled in 5 ' and modified nucleotides 3'-O-amino-2 ', 3'-dideoxyadenosine-5'-triphosphate (ONH2 gel) or modified nucleotides 3'-biot-EDA-2', 3'-dideoxyadenosine-5'-triphosphate ( Biot-EDA gel); on SDS-PAGE gel (No: no enzyme present; wt: truncated wild-type TdT with sequence SEQ ID No. 3; DSi: Variants i defined in Table 1).
    Detailed description of the invention
    Definitions
    Amino acids are represented in this document by the one-letter or three-letter code according to the following nomenclature: A: Ala (alanine); R: Arg (arginine); N: Asn (asparagine); D: Asp (aspartic acid); C: Cys (cysteine); Q: Gin (glutamine); E: Glu (glutamic acid); G: Gly (glycine); H: His (histidine); I: Ile (isoleucine); L: Leu (leucine); K: Lys (lysine); M: Met (methionine); F: Phe (phenylalanine); P: Pro (proline); S: Ser (serine); T: Thr (threonine); W: Trp (tryptophan); Y: Tyr (tyrosine); V: Val (valine).
    By “percentage of identity” between two nucleic acid or amino acid sequences within the meaning of the present invention is meant a percentage of identical nucleotides or amino acid residues between the two sequences to be compared, obtained after the best alignment, this percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length. The best or optimal alignment is the alignment for which the percentage of identity between the two sequences to be compared, as calculated below, is the highest. Sequence comparisons between two nucleic acid or amino acid sequences are traditionally carried out by comparing these sequences after having optimally aligned them, said comparison being carried out by segment or by comparison window to identify and compare the local regions of sequence similarity. The optimal alignment of the sequences for the comparison can be carried out, besides manually, by means of the algorithm of local homology of Smith and Waterman (1981) (Ad. App. Math. 2: 482), by means of the local homology algorithm of Neddleman and Wunsch (1970) (J. Mol. Biol. 48: 443), using the similarity search method of Pearson and Lipman (1988) (Proc. Natl. Acad. Sci. USA 85: 2444), using computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics
    Computer Group, 575 Science Dr., Madison, WI), using the Mutalin online alignment software (http://niiiltalin.toiilouse.inra.fr/niiiltali.n/multaiiii.html; 1988, Nucl. Acids Res ., 16 (22), 10881-10890). The percentage of identity between two nucleic acid or amino acid sequences is determined by comparing these two optimally aligned sequences per comparison window in which the region of the nucleic acid or amino acid sequence to be compared. may include additions or deletions with respect to the reference sequence for optimal alignment between these two sequences. The percentage of identity is calculated by determining the number of identical positions for which the nucleotide or the amino acid residue is identical between the two sequences, by dividing this number of identical positions by the total number of positions in the comparison window. and multiplying the result obtained by 100 to obtain the percentage of identity between these two sequences.
    The variants which are the subject of the present invention are described as a function of their mutations on specific residues, the positions of which are determined by alignment with, or reference to, the enzymatic sequence SEQ ID No. 1. In the context of the invention, any variant carrying these same mutations on functionally equivalent residues is also targeted. By "functionally equivalent residue" is meant a residue in a sequence of a DNA polymerase of the polX family of sequence homologous to SEQ ID No. 1 and having an identical functional role. Functionally equivalent residues are identified using sequence alignments, for example using the online alignment software Mutalin (http://multalin.toulouse.inra.fr/multalin/multalin.html; 1988, Nucl. Acids Res., 16 (22),
    1088.1-10890). After alignment, the functionally equivalent residues are found at homologous positions on the different sequences considered. Sequence alignments and the identification of functionally equivalent residues can be carried out between any DNA polymerase of the polX family and their natural variants, including interspecies. For example, the residue L40 of human TdT (UniProtKB P04053) is functionally equivalent to the residue M40 of chicken TdT (UniProtKB P36195) and the residue V40 of the Polp of Pan troglodytes (UniProtKB H2QUI0), said residues being considered after alignment of the sequences (Figure 2).
    By "functional fragment" is meant a fragment of DNA polymerase of the polX family exhibiting DNA polymerase activity. The fragment can comprise 100, 200, 300, 310, 320, 330, 340, 350, 360, 370, 380 or more consecutive amino acids of a DNA polymerase of the polX family. Preferably, the fragment contains 380 consecutive amino acids of a DNA polymerase of the polX family consisting of the catalytic fragment of said enzyme.
    The terms “mutant” and “variant” can be used interchangeably to refer to polypeptides derived from DNA polymerases of the polX family, or derived from functional fragments of such DNA polymerases, and in particular from a TdT such as Murine TdT according to the sequence SEQID N 0 1, and comprising an alteration, namely a substitution, an insertion and / or deletion, at one or more positions and having a DNA polymerase activity. Variants can be obtained by various techniques well known in the art. In particular, examples of techniques for modifying the DNA sequence encoding the wild-type protein include, but are not limited to, site-directed mutagenesis, random mutagenesis and the construction of synthetic oligonucleotides.
    The term "modification" or "mutation" as used herein with respect to an amino acid position or residue means that the amino acid in the position under consideration has been modified from the amino acid of the protein of reference wild type. Such modifications include the substitution, deletion and / or insertion of one or more amino acids, and in particular 1 to 5, there 4, 1 to 3, 1 to 2 amino acids, at one or more positions, and in particular at 1, 2, 3, 4, 5 or more positions.
    The term "substitution", in relation to an amino acid position or residue, means that the amino acid in the particular position has been replaced by another amino acid than that in wild or parent DNA polymerase. Preferably, the term substitution designates the replacement of an amino acid residue by another chosen from 20 natural amino acid residues, rare amino acid residues of natural origin (for example, hydroxyproline , hydroxylysine, allohydroxylysine, 6-N-methylysine, N-ethylglycine, N-methylglycine, N-ethylasparagine, allo-isoleucine, N-methylisoleucine, Nmethylvaline, pyroglutamine, aminobutyric acid, ornithine), and the rare unnatural amino acid residues, often synthetically produced (for example, norleucine, norvaline and cyclohexyl-alanine). Preferably, the term substitution designates the replacement of an amino acid residue with another chosen from among the 20 standard amino acid residues of natural origin (G, P, A, V, L, I, M, C , F, Y, W, H, K, R, Q, N, E, D, S and T). The substitution can be a conservative or a non-conservative substitution. Conservative substitutions are made within the same group of amino acids, among basic amines (arginine, lysine and histidine), acid amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine) , hydrophobic amino acids (methionine, leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine) and small amino acids (glycine, alanine, serine and threonine). In this document, the following terminology is used to designate a substitution: R454F indicates that the amino acid residue in position 454 of SEQ ID No. 1 (arginine, R) is replaced by a phenylalanine (F). N474S / T / N / Q means that the amino acid residue at position 474 (Asparagine, N) can be replaced by a serine (S), a threonine (T), an asparagine (N) or a glutamine (Q) . The + sign indicates a combination of substitutions.
    The invention relates to DNA polymerase variants of the polX family (EC 2.7.7.7; Advances inProtein Chemistry, Vol. 71,401-440) capable of synthesizing a nucleic acid molecule without a template strand, and in particular a strand d 'DNA or RNA. The DNA polymerases of the polX family include in particular DNA polymerase Ροϊβ (UniProt P06746 in humans;
    Q8K409 in mice), Polo, Ροϊλ (UniProt Q9UGP5 in humans; Q9QUG2 and
    Q9QXE2 in mice) and Polp (UniProt Q9NP87 in humans; Q9JIW4 in mice), Pol4 (UniProt A7TER5 in yeast Vanderwaltozyma polyspora; P25615 in yeast Saccharomyces cerevisiae), and Deoxyribonucleotidyl-transferase (2.7- 7.31; UniProt P04053 in humans; P09838 in mice).
    A more particular subject of the invention is a variant of DNA polymerase of the polX family capable of synthesizing a nucleic acid molecule without a template strand, or a variant of a functional fragment of such a polymerase, said variant comprising at least a mutation of a residue at at least one position selected from the group consisting of M33O, T331, G332, G333, F334, K338, H342, D343, V344, D345, F346, A397, D399, D434, V436, A446,
    L447, L448, G449, W450, G452, Q455, F456, E457, R458, R461, N474, E491, D501, Y502,
    1503, P505, R508, N509 and A510, or a functionally equivalent residue, the positions indicated being determined by alignment with, or reference to, the sequence SEQ ID No. 1.
    In one embodiment, the variant is capable of one strand of DNA and / or one strand of RNA.
    ίο
    By “comprising at least one mutation” or “comprising at least one mutation”, it is meant that the variant has one or more mutations as indicated with respect to the polypeptide sequence SEQ ID No. 1, but that it may have d 'other modifications, including substitutions, deletions or additions.
    In general, the mutation of one or more residues at the above positions allows the expansion of the catalytic pocket (by targeting for example the positions W450, D434, D435, H342, D343, T331, D399, R461, and / or R508), increasing the accessibility to the catalytic bag (by targeting, for example, positions R458, E455, A397, K338, and / or N509), and / or gives greater flexibility to the structure of the enzyme allowing it to receive modified nucleotides having a large steric hindrance (by targeting for example the positions V436, F346, V344, F334, M33O, L448, E491, E457 and / or N474).
    The object variants of the present invention can be variants of Pol IV, Pol μ, Ροϊβ, Ροϊλ or TdT, preferably variants of Pol IV, Pol μ, or TdT. Alternatively, the variants can be variants of chimeric enzymes, combining for example portions of different sequences of at least two DNA polymerases of the polX family.
    In a particular embodiment, the variant has at least 60% identity with the sequence according to SEQ ID No. 1, preferably at least 70%, 80%, 85%, 90%, 95%, 96%, 97% , 98%, 99% and less than 100% identity with the sequence according to SEQ ID No. 1.
    According to the invention, the mutation can consist of a substitution, a deletion or an addition of one or more amino acid residues. In the case of deletion, the annotation X is used, which indicates that the codon coding for the residue considered is replaced by a STOP codon, all the following amino acids as well as the residue in question are therefore deleted. Thus, the D501X mutation means that the enzyme ends at the residue preceding the aspartic acid (D) at position 501, that is to say leucine (L) at position 500, all the residues beyond having been deleted. The annotation 0 indicates on the other hand a simple punctual deletion of the residue considered. Thus, the D5O10 mutation means that the aspartic acid (D) at position 501 has been deleted.
    Preferably, the variant according to the invention comprises at least one mutation of a residue at at least one position selected from the group consisting of T331, G332, G333, F334,
    D343, L447, L448, G449, W450, G452, Q455, E457 and R508, or a functionally equivalent residue, the positions indicated being determined by alignment with SEQ ID No.1.
    In a particular embodiment, the variant further comprises at least one mutation of a residue in at least the semi-conserved region of sequence X1X2GGFR1R2GKX3X4 (SEQ ID No. 4), in which
    Xi represents a residue chosen from Μ, I, V, L
    X2 represents a residue chosen from T, A, M, Q
    X3 represents a residue chosen from M, K, E, Q, L, S, P, R, D
    X4 represents a residue chosen from T, I, M, F, K, V, Y, E, Q, H, S, R, D.
    Preferably, said variant has at least one substitution of a residue at at least one position Ri, R2 and / or K of the semi-conserved region of sequence SEQ ID No. 4.
    In another particular embodiment, the variant further comprises at least one mutation of a residue in at least one semi-conserved region of sequence X1X2LGX3X4GSR1X5X6ER2 (SEQ ID No. 5) in which
    Xi represents a residue chosen from A, C, G, S
    X2 represents a residue chosen from L, T, R
    X3 represents a residue chosen from W, Y
    X4 represents a residue chosen from T, S, I
    X5 represents a residue chosen from Q, L, H, F, Y, N, E, D or 0
    Xô represents a residue chosen from F, Y
    Preferably, said variant has at least one substitution of a residue at at least one position S, Ri and / or E of the semi-conserved region of sequence SEQ ID No. 5.
    In another particular embodiment, the variant further comprises at least one mutation of a residue in at least one semi-conserved region of sequence LX1YX2X3PX4X5RNA (SEQ ID No. 6) in which
    Xi represents a residue chosen from D, E, S, P, A, K
    X2 represents a residue chosen from I, L, Μ, V, A, T
    Xa represents a residue chosen from E, Q, P, Y, L, K, G, N
    X 4 represents a residue chosen from W, S, V, E, R, Q, T, C, K, H
    X5 represents a residue chosen from E, Q, D, H, L.
    Preferably, said variant exhibits at least one deletion of the residue at position Xi and / or at least one substitution at positions R and / or N of the semi-conserved region of sequence SEQ ID No. 6.
    In a particular embodiment, the variant comprises a substitution of a residue at at least one position selected from the group consisting of K338, H342, A397, S453, E457, N474, D501, Y502, 1503, R508 and N509, or a functionally equivalent residue, preferably a substitution of a residue at at least one position selected from the group consisting of A397, E457, N474, D501, Y502 and 1503, or a functionally equivalent residue, the positions indicated being determined by alignment with SEQ ID No. 1.
    The invention preferably relates to a variant of a DNA polymerase of the polX family comprising at least one substitution from the group consisting of K338A / C / G / S / T / N, H342A / C / G / S / T / N , A397R / H / K / D / E, S453A / C / G / S / T, E457G / N / S / T, N474S / T / N / Q,
    D501A / G / X, Y502A / G / X, I503A / G / X, R508A / C / G / S / T, N509A / C / G / S / T.
    Advantageously, the variant comprises a combination of substitutions selected from the group mentioned above. The combination can consist of 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 substitutions selected from this group.
    A more particular subject of the invention is variants of a DNA polymerase of the polX family capable of synthesizing a nucleic acid molecule, such as a DNA or RNA strand without template strand, or of a fragment functional of such a polymerase, said variants comprising at least one combination of mutations described in Table 1, the positions indicated being determined by alignment with SEQ ID No. 1.
    Table 1: Examples of combinations of mutations of DNA polymerase variants of the polX family
    Combination of mutations DSI R454F - E457N - A397D DS2 R454F-E457N DS3 R454Y - E457N - A397D DS4 R454Y - E457N DS5 R454W - E457N - A397D DS6 R454W - E457N DS7 R335A- E457N -A397D DS8 R335A- E457N DS9 R335G - E457N - A397D DS10 R335G - E457N DS11 R335N - E457N - A397D DS12 R335N - E457N DS13 R335D - E457N - A397D DS14 R335D - E457N DS15 R336K- E457N -A397D DS16 R336K-E457N DS17 R336H - E457N - A397D DS18 R336H - E457N DS19 R336A- E457N -A397D DS20 R336A- E457N DS21 R336G - E457N - A397D DS22 R336G - E457N DS23 R336N - E457N - A397D DS24 R336N - E457N DS25 R336D - E457N - A397D DS26 R336D - E457N DS27 R454A - E457N DS28 R454A - E457A
    DS29 R454A - E457G DS30 R454A - E457D DS31 E457N DS32 E457D DS33 R454A - E457N - A397D DS34 R454A - E457N - A397K DS35 R454A - E457N - N474S DS36 R454A - E457D - A397D DS37 D501X DS38 D501X-E457N DS39 D501X- E457N - A397D DS40 R454F - E457S - A397D DS41 R454F - E457S DS42 R454Y - E457S - A397D DS43 R454Y - E457S DS44 R454W - E457S - A397D DS45 R454W - E457S DS46 R335A- E457S - A397D DS47 R335A - E457S DS48 R335G - E457S - A397D DS49 R335G - E457S DS50 R335N - E457S - A397D DS51 R335N - E457S DS52 R335D - E457S - A397D DS53 R335D - E457S DS54 R336K- E457S-A397D DS55 R336K-E457S DS56 R336H - E457S - A397D DS57 R336H - E457S DS58 R336A- E457S - A397D DS59 R336A - E457S DS60 R336G - E457S - A397D
    DS61 R336G - E457S DS62 R336N - E457S - A397D DS63 R336N - E457S DS64 R336D - E457S - A397D DS65 R336D - E457S DS66 R454A - E457S DS70 E457S DS72 R454A - E457S - A397D DS73 R454A- E457S-A397K DS74 R454A - E457S - N474S DS75 D501X - E457S DS76 D501X-E457S- A397D DS77 R454F - E457T - A397D DS78 R454F - E457T DS79 R454Y - E457T - A397D DS80 R454Y - E457T DS81 R454W - E457T - A397D DS82 R454W - E457T DS83 R335A- E457T-A397D DS84 R335A - E457T DS85 R335G - E457T-A397D DS86 R335G - E457T DS87 R335N - E457T-A397D DS88 R335N - E457T DS89 R335D - E457T-A397D DS90 R335D - E457T DS91 R336K- E457T - A397D DS92 R336K-E457T DS93 R336H - E457T-A397D DS94 R336H - E457T DS95 R336A- E457T-A397D DS96 R336A - E457T
    DS97 R336G - E457T-A397D DS98 R336G - E457T DS99 R336N - E457T-A397D DS100 R336N - E457T DS101 R336D - E457T-A397D DS102 R336D - E457T DS103 R454A - E457T DS104 E457T DS105 R454A - E457T-A397D DS106 R454A - E457T-A397K DS107 R454A - E457T - N474S DS108 D501X - E457T DS109 D501X- E457T-A397D DS110 D502X DS111 D502X-E457N DS112 D502X- E457TN - A397D DS113 D502X - E457S DS114 D502X-E457S- A397D DS115 D502X - E457T DS116 D502X- E457T-A397D DS117 D503X DS118 D503X-E457N DS119 D503X- E457TN - A397D DS120 D503X - E457S DS121 D503X-E457S- A397D DS122 D503X - E457T DS123 D503X- E457T-A397D
    In a particular embodiment, the variant is a chimeric construction of DNA polymerases of the polX family. By “chimeric construction” is meant a chimeric enzyme constituted by the supply, and in particular the fusion or the conjugation, of one or more determined sequences of an enzyme member of the polX family in replacement of one or more homologous sequences in the DNA polymerase variant considered.
    Thus, the invention provides a variant of the TdT of sequence SEQ ID No. 1 comprising, in addition to one or more point mutations at one and / or the other of the above positions, a substitution of the residues between the positions C378 to L406, or the functionally equivalent residues, by the residues H363 to C390 of the Polp polymerase of sequence SEQ ID No. 2, or the functionally equivalent residues.
    Alternatively or additionally, the variants which are the subject of the present invention may exhibit a deletion of one or more successive amino acid residues at the level of the N-terminal part. These deletions can in particular target one or more enzymatic domains involved in the binding with other proteins and / or involved in cellular localization. For example, the TdT polypeptide sequence comprises in N-terminal a BRCT domain of interaction with other proteins such as Ku70 / 80 and a localization domain at the nucleus (NLS).
    In a particular embodiment of the present invention, the variant is a variant of the TdT of sequence SEQ ID No. 1 having, in addition to one or more of the mutations described above, a suppression of residues 1-129 corresponding to the N end -terminal of wild TdT.
    In certain specific cases, the mutagenesis strategies can be guided by known information such as the sequences of natural variants, the comparison of sequence with linked proteins, physical properties, the study of a three-dimensional structure or computer simulations involving several entities.
    The present invention relates to a nucleic acid encoding a variant of a DNA polymerase of the polX family capable of synthesizing a template strandless nucleic acid molecule according to the present invention. The present invention also relates to a cassette for the expression of a nucleic acid according to the present invention. It further relates to a vector comprising a nucleic acid or an expression cassette according to the present invention. The vector can be selected from a plasmid and a viral vector.
    The nucleic acid encoding the DNA polymerase variant can be DNA (cDNA or gDNA), RNA, a mixture of the two. H may be in single chain or duplex form or a mixture of the two. It can comprise modified nucleotides, comprising for example a modified bond, a modified purine or pyrimidine base, or a modified sugar. It can be prepared by any method known to a person skilled in the art, including chemical synthesis, recombination, mutagenesis, etc.
    The expression cassette comprises all the elements necessary for the expression of the variant of a DNA polymerase of the polX family capable of synthesizing a nucleic acid molecule without template strand according to the present invention, in particular the elements necessary for transcription and to translation in the host cell. The host cell can be prokaryotic or eukaryotic. In particular, the expression cassette includes a promoter and a terminator, optionally an amplifier. The promoter can be prokaryotic or eukaryotic. Examples of preferred prokaryotic promoters are: Lacl, LacZ, pLacT, ptac, pARA, pBAD, bacteriophage T3 or T7 RNA polymerase promoters, the polyhedrine promoter, the PR or PL promoter of phage lambda. Examples of preferred eukaryotic promoters are: CMV early promoter, HSV thymidine kinase promoter, SV40 early or late promoter, mouse L-metallothionein promoter, and LTR regions of certain retroviruses. In general, for choosing a suitable promoter, those skilled in the art can advantageously refer to the work by Sambrook et al. (1989) or to the techniques described by Fuller et al. (1996; Immunology in Current Protocols in Molecular Biology).
    The present invention relates to a vector carrying a nucleic acid or an expression cassette encoding a variant of a DNA polymerase of the polX family capable of synthesizing a template strandless nucleic acid molecule according to the present invention. The vector is preferably an expression vector, that is to say that it comprises the elements necessary for the expression of the variant in the host cell. The host cell can be a prokaryote, for example E. coli, or a eukaryote. The eukaryote can be a lower eukaryote such as a yeast (for example, P. Pastoris or K. lactis) or a fungus (for example of the genus Aspergillus) or a higher eukaryote such as an insect cell (for example Sf9 or Sf21) , mammal or plant. The cell can be a mammalian cell, for example COS (green monkey cell line) (for example, COS 1 (ATCC CRL-1650), COS 7 (ATCC
    CRL-1651), CHO (US 4,889,803; US 5,047,335, CHO-K1 (ATCC CCL-61)), mouse cells and human cells. In a particular embodiment, the cell is nonhuman and nonembryonic. The vector can be a plasmid, a phage, a phagemid, a cosmid, a virus, a YAC, a BAC, a plasmid pTi & Agrobacterium, etc. The vector can preferably comprise one or more elements selected from an origin of replication, a multiple cloning site and a selection gene. In a preferred embodiment, the vector is a plasmid. Non-exhaustive examples of prokaryotic vectors are the following: pQE70, pQE60, pQE-9 (Qiagen), pbs, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK2333, pDR540, pBR322, and pRIT5 (Pharmacia), pET (Novagen). Non-exhaustive examples of eukaryotic vectors are the following: pWLNEO, pSV2CAT, pPICZ, pcDNA3.1 (+) Hyg (Invitrogen), pOG44, pXTl, pSG (Stratagene); pSVK3, pBPV, pCI-neo (Stratagene), pMSG, pSVL (Pharmacia); and pQE-30 (QLAexpress). The viral vectors can be nonexhaustively adenoviruses, AAVs, HSVs, lentiviruses, etc. Preferably, the expression vector is a plasmid or a viral vector.
    The sequence encoding the variant according to the present invention may or may not include a signal peptide. If it does not, a methionine can optionally be added to the N-terminus. In another alternative, a heterologous signal peptide can be introduced. This heterologous signal peptide can be derived from a prokaryote such as E. coli or from a eukaryote, in particular a mammalian, insect or yeast cell.
    The present invention relates to the use of a polynucleotide, an expression cassette or a vector according to the present invention for transforming or transfecting a cell. The present invention relates to a host cell comprising a nucleic acid, an expression cassette or a vector encoding a variant of a DNA polymerase of the polX family capable of synthesizing a template strandless nucleic acid molecule and its use for producing a variant of a DNA polymerase of the polX family capable of synthesizing a recombinant template stranded nucleic acid molecule according to the present invention. The term "host cell" includes daughter cells resulting from the culture or growth of this cell. In a particular embodiment, the cell is non-human and non-embryonic. It also relates to a method for producing a variant of a DNA polymerase of the polX family capable of synthesizing a nucleic acid molecule without a recombinant template strand according to the present invention comprising the transformation or transfection of a cell with a polynucleotide, an expression cassette or a vector according to the present invention; culturing the transfected / transformed cell; and harvesting the variant of a DNA polymerase of the polX family capable of synthesizing a template strandless nucleic acid molecule produced by the cell. In an alternative embodiment, the method for producing a variant of a polX family DNA polymerase capable of synthesizing a recombinant template strandless nucleic acid molecule according to the present invention comprising providing a cell comprising a polynucleotide, an expression cassette or a vector according to the present invention; culturing the transfected / transformed cell; and harvesting the variant of a DNA polymerase of the polX family capable of synthesizing a template strandless nucleic acid molecule produced by the cell. In particular, the cell can be transformed / transfected in a transient or stable manner with the nucleic acid encoding the variant. This nucleic acid can be contained in the cell as an episome or as a chromosome. The methods for producing recombinant proteins are well known to those skilled in the art. For example, mention may be made of the specific modes described in ETS 5,004,689, EP 446,582, Wang et al. (Sci. Sin. B 24: 1076-1084, 1994 and Nature 295, page 503) for a production in E. coli, and JAMES et al. (Protein Science (1996), 5: 331-340) for production in mammalian cells.
    The DNA polymerase variants according to the present invention are of particular interest for the synthesis of template strandless nucleic acids. More particularly, the variants according to the invention have an increased catalytic pocket which is particularly suitable for the synthesis of nucleic acid using modified nucleotides having a larger bulk than natural nucleotides. The variants according to the invention can in particular make it possible to incorporate into a strand of nucleic acid modified nucleotides such as those described in application WO2016 / 034807.
    A subject of the invention is therefore also a use of a variant of a DNA polymerase of the polX family according to the present invention, for synthesizing a nucleic acid molecule without template strand, from nucleotides modified into 3'-OH , and in particular those described in application W02016034807.
    The subject of the invention is also a method of enzymatic synthesis of a nucleic acid molecule without a template strand, according to which a primer strand is brought into contact with at least one nucleotide, preferably a nucleotide modified to 3'-OH, in presence of a variant of a DNA polymerase of the polX family according to the invention.
    Advantageously, the variants according to the invention can be used to implement the synthesis process described in application WO2015 / 159023.
    The subject of the invention is also a kit for the enzymatic synthesis of a template strandless nucleic acid molecule comprising at least one variant of a DNA polymerase of the polX family according to the invention, nucleotides, preferably modified nucleotides in 3'-OH, and optionally at least one nucleotide primer.
    Other characteristics and advantages of the invention will appear better on reading the following examples given, of course, by way of illustration and not limitation.
    Examples
    Example 1 Generation, production and purification of DNA polymerase variants of the polX family according to the invention
    Generation of producing strains
    The truncated mouse TdT gene was generated from the plasmid pET28b, the construction of which is described in [Boulé et al., 3998, Mol. Biotechnol., 10, 199-208]. The corresponding sequence SEQ CD N ° 3 (corresponding to SEQ ID N ° 1 truncated from the first 120 amino acids) was amplified using the following primers:
    ❖ T7-pro: TAATACGACTCACTATAGGG (SEQ ID N ° 7) ❖ T7-ter: GCTAGTTATTGCTCAGCGG (SEQ ID N ° 8) using standard PCR and molecular biology techniques. It was cloned into a plasmid pET32 to give the vector pET32-SEQ ID No. 3.
    The plasmid pET32- SEQ ID No. 3 was first sequenced and then transformed into the commercial E. coli strains BL21 (DE3) (Novagen). Colonies capable of growing on kanamycin / chloramphenicol dishes were isolated and noted Ec- SEQ ID N ° 3
    Variant generation
    The vector pET32-SEQ ID No. 3 was used as the starting vector. Primers comprising the point mutation (or in some cases the point mutations if these are sufficiently close) were generated from the Agilent online tool: (http: //www.genomies.agilent.eom/ primerDesignProgram.jsp)
    The QuickChange II kit (Agilent) was used to generate the plasmids of the variants containing the desired mutation (s). The mutagenesis protocol given by the manufacturer was scrupulously followed in order to obtain a plasmid pET32-DSi (i is the number of the variant considered given in table 1). At the end of the procedure, the plasmid pET32-DSx was first sequenced and then transformed into the commercial E. coli strains BL21 (DE3) (Novagen). Colonies capable of growing on kanamycin / chloramphenicol dishes were isolated and noted Ec-DSx.
    Production
    The Ec-SEQ ID No. 3 and Ec-DSx cells were precultured in a 250 ml Erlenmeyer flask containing 50 ml of LB medium to which were added appropriate quantities of kanamycin and chloramphenicol. The culture was incubated at 37 ° C with shaking overnight. The preculture was then used to seed a 5 L Erlenmeyer flask containing 2 L of LB medium supplemented with appropriate amounts of kanamycin and chloramphenicol. The initial optical density (OD) was 0.01. The culture was incubated at 37 ° C with shaking. The OD was regularly measured until a value between 0.6 and 0.9 was reached. Once this value was reached, 1 ml of 1 M isopropyl β-D-1-thiogalactopyranoside was added to the culture medium. The culture was again incubated at 37 ° C overnight. The cells were then harvested by centrifugation without exceeding 5,000 rpm. The different pellets obtained were combined in a single pellet during washing with lysis buffer (20 mM TrisHC1, pH 8.3, 0.5 M NaCl). The cell pellet was frozen at -20 ° C. It can be kept for several months.
    Extraction
    The cell pellet frozen in the previous step was thawed in a water bath heated to between 25 and 37 ° C. Once fully thawed, it was re-suspended in approximately 100 mL of lysis buffer. Particular attention has been paid to the re-suspension which must lead to a very homogeneous solution and in particular to the total absence of aggregates. Thus resuspended, the cells were lysed using a French press under a pressure of 14,000 psi. The lysate collected was centrifuged at high speed, 10,000 g for 1 h to 1 h 30 min. The centrifugate was filtered through a 0.2 μΜ filter and collected in a tube of sufficient volume.
    Purification
    TdT was purified on an affinity column. 5 mL His-Trap Crude columns (GE Life Sciences) were used with peristaltic pumps (Peristaltic Pump - MINIPULS® Evolution, Gilson). First the column was balanced using 2 to 3 CV (column volume) of lysis buffer. The centrifugate from the previous step was then loaded onto the column at a speed of between 0.5 and 5 ml / min approximately. Once all of the centrifugate had been loaded, the column was washed using 3 CV of lysis buffer and then 3 CV of washing buffer (20 mM Tris-HCl, pH 8.3, 0.5 M NaCl, 60 mM imidazol). At the end of this step, the elution buffer (20 mM Tris-HCl, pH 8.3, 0.5 M NaCl, 1 M imidazol) was injected into the column at approximately 0.5 to 1 ml / min for a total volume of 3 CV. During the entire elution phase, the column outlet was collected in 1 ml fractions. These fractions were analyzed by SDS-PAGE to determine which are the fractions containing the elution peak. Once determined, these were combined in a single fraction and dialyzed against dialysis buffer (20 mM Tris-HCl, pH 6.8, 200 mM NaCl, 50 mM MgOAc, 100 mM [NEUkSCb. The TdT was then concentrated (Amicon Ultra-30 centrifuge filters, Merk Millipore) to a final concentration of 5 to 15 mg / mL The concentrated TdT was frozen at -20 ° C for long-term storage after addition of 50% glycerol. During the entire purification phase, aliquots of the different samples were taken (approximately 5 μL) for analysis in SDS-PAGE gel, the results of which are presented in FIG. 1.
    Example 2 Alignment of Sequences Between Different Polymerases of the Pol X Family Which Can Be Used for the Creation of Variants According to the Invention
    Different DNA polymerases from the Pol X family were aligned using the Mutalin online alignment software (http://multalin.toulouse.mra.fr/multalin/multalin.html, accessed 04/04/2016).
    Table 2: Aligned sequences
    Username DNA polymerase Species Length Q9NP87 Pol μ (SEQ. ID N ° 2) Homo sapiens 494 H2QUI0 Pol μ (SEQ ID N ° 9) Pan troglodytes 494 Q924W4 Pol μ (SEQ ID N ° 10) Mus musculus 496 F1P657 TdT (SEQ ID N ° ll) Canis lupus familiaris 509 Q3UZ80 TdT (SEQ ID N ° l) Mus musculus 510 P36195 TdT (SEQ ID N ° 12) Gallus gallus 506 P04053 TdT (SEQ ID N ° 13) Homo sapiens 509
    The alignments obtained are shown in Figure 2.
    Example 3 - Study of activity of the variants in the presence of non-natural substrates
    The activity of different variants according to the invention was determined by the following test. The results were compared to those obtained with the natural enzyme from which each variant is derived.
    Activity test
    Table 3: Reaction mixture
    Reagent Concentration volume H 2 O - 15 μί Primer 500 nM 2.5 μί
    Buffer lOx 2.5 μΙ_ Modified nucleotide 250 μΜ 2.5 μΙ_ Enzyme 20 μΜ 2.5 μΙ_
    The primer used, of sequence 5'-AAAAAAAAAAGGGG-3 '(SEQ ID No. 14), was previously radioactively labeled in 5 ′ using a standard labeling protocol involving the enzyme PNK (NEB) and the use of radioactive ATP (PerkinElmer).
    The 10x buffer consisting of 250 mM Tris-HCl pH 7.2, 80 mM MgCh, 3.3 mM ZnSCh was used.
    The modified nucleotides used are 3'-O-amino-2 ', 3'-dideoxynucleotides-5'-triphosphate (ONH2, Firebird Biosciences) or 3'-biot-EDA-2', 3'-dideoxynucleotides-5 ' -triphosphate (Biot-EDA, Jena Biosciences), such as 3'-O-amino-2 ', 3'-dideoxyadenosine-5'-triphosphate or
    3'-biot-EDA-2 ', 3'-dideoxyadenosine-5'-triphosphate for example. The 3'-O-amino group is a larger group attached to the 3'-OH end. The 3’-biot-EDA group is an extremely bulky and non-flexible group attached to the 3′-OH end.
    The incorporation performance of a modified nucleotide given by the variants listed in table 1, compared to the natural TdT (SEQ ID No. 3) was evaluated by performing simultaneous activity tests, for which only the enzyme varies.
    The reagents were added in the order given in table 3 above and then incubated at 37 ° C for 90 min. The reaction was then stopped by the addition of blue formamide (100% formamide, 1 to 5 mg of bromophenol blue; Simga)
    Gel and X-ray
    A 16% polyacrylamide denaturing gel (Biorad) was used for the analysis of the previous activity test. The gel was previously poured and left to polymerize. It was then mounted on an electrophoresis tank of appropriate dimensions filled with TBE buffer (Sigma). The different samples were loaded directly onto the gel without pre-treatment.
    The gel was then subjected to a potential difference of 500 to 2,000 V for 3 to 6 hours.
    Once the migration was satisfactory, the gel was disembodied and then transferred to an incubation cassette. A phosphor screen (Amersham) was used for 10 to 60 min for the revelation carried out using a Typhoon instrument (GE Life Sciences) previously configured with an adequate detection mode.
    Results
    The comparative results of the two enzymes used are presented in FIG. 3.
    More specifically, on the first gel (Incorporation 0NH2), the natural TdT (column wt) is unable to incorporate the modified nucleotides 3'-O-amino-2 ', 3'-dideoxyadenosine-5'triphosphate as shown in the comparison with the negative control (column No).
    Among the different variants, 3 different groups can be observed:
    A first group of variants (columns DS7 to DS34) are capable of approximately 50% incorporation.
    A second group of variants (columns DS46 to DS73) are capable of more than 95% incorporation, sometimes more than 98%.
    A third group of variants (columns DS83 to DS 106) is capable of incorporation between 60 and 80%.
    On the second gel (Biot-EDA incorporation), the natural TdT (wt column) is also unable to incorporate the modified nucleotides 3'-biot-EDA-2 ', 3'-dideoxyadenosine-5'triphosphate as shown in the comparison with the negative control (column No).
    Among the different variants, 3 different groups can be observed:
    A first group of variants (columns DS7 to DS34) is capable of incorporation between 5 and 10% approximately.
    A second group of variants (columns DS46 to DS73) is capable of more than 30% incorporation, sometimes more than 40%.
    A third group of variants (columns DS83 to DS 106) is capable of incorporation between 10 and 25%.
    These results confirm that the TdT variants according to the invention are all capable of using modified nucleotides, in particular 3'-OH, as substrate, unlike the wild-type enzyme. In a particularly advantageous manner, certain variants have very high incorporation rates and this even in the presence of nucleotides carrying modifications tending to very significantly increase the steric hindrance of said nucleotide.
    权利要求:
    Claims (23)
    [1" id="c-fr-0001]
    1. Variant of a DNA polymerase of the polX family capable of synthesizing a nucleic acid molecule without a template strand, or of a functional fragment of such a polymerase, said variant comprising at least one mutation of the residue at position E457 , or a functionally equivalent residue, the position indicated being determined by alignment with SEQ IDN ° 1.
    [2" id="c-fr-0002]
    2. A variant of a DNA polymerase of the polX family according to claim 1, said variant being capable of synthesizing a strand of DNA and / or a strand of RNA.
    [3" id="c-fr-0003]
    3. A variant of a DNA polymerase of the polX family according to claim 1 or 2, said variant being a variant of Pol IV, Pol μ, or of terminal deoxyribonucleotidyl transferase (TdT).
    [4" id="c-fr-0004]
    4. Variant of a DNA polymerase of the polX family according to one of the preceding claims, and having at least 60% identity with the sequence according to SEQ ID No. 1, preferably at least 70%, 80%, 85% , 90%, 95%, 96%, 97%, 98%, 99% identity with the sequence according to SEQ ID No. 1.
    [5" id="c-fr-0005]
    5. Variant of a DNA polymerase of the polX family according to one of the preceding claims, in which the mutation consists of a substitution, a deletion or an addition of one or more amino acid residues.
    [6" id="c-fr-0006]
    6. Variant of a DNA polymerase of the polX family according to one of the preceding claims, in which the mutation consists of a substitution, preferably chosen from E457G / N / S / T.
    [7" id="c-fr-0007]
    7. Variant of a DNA polymerase of the polX family according to one of the preceding claims, said variant further comprising at least one mutation of a residue at at least one position selected from the group consisting of M33O, T331, G332, G333, F334, K338, H342, D343, V344, D345, F346, A397, D399, D434, V436, A446, L447, L448, G449, W450, G452, Q455, F456, R458, R461, N474, E491, D501 Y502,1503, P505, R508, N509 and A510, or a functionally equivalent residue, preferably in the group consisting of
    T331, G332, G333, F334, D343, L447, L448, G449, W450, G452, Q455, R461 and R508, or a functionally equivalent residue, the positions indicated being determined by alignment with SEQIDN ° 1.
    [8" id="c-fr-0008]
    8. Variant of a DNA polymerase of the polX family according to one of the preceding claims, said variant having at least one mutation of a residue in at least one semi-conserved region of sequence (i) X1X2GGFR1R2GKX3X4 (SEQ ID N ° 4), in which
    Xi represents a residue chosen from Μ, I, V, L X2 represents a residue chosen from T, A, M, Q X3 represents a residue chosen from M, K, E, Q, L, S, P, R, D X4 represents a residue chosen from T, I, M, F, K, V, Y, E, Q, H, S, R, D (ii) X1X2LGX3X4GSR1X5X6ER2 (SEQ ID N ° 5) in which
    Xi represents a residue chosen from A, C, G, S
    X2 represents a residue chosen from L, T, R
    X3 represents a residue chosen from W, Y
    X4 represents a residue chosen from T, S, I
    X5 represents a residue chosen from Q, L, H, F, Y, N, E, D or 0
    Xô represents a residue chosen from F, Y (iii) LX1YX2X3PX4X5RNA (SEQ ID N ° 6)
    Xi represents a residue chosen from D, E, S, P, A, K X2 represents a residue chosen from I, L, Μ, V, A, T X3 represents a residue chosen from E, Q, P, Y, L, K, G, N X4 represents a residue chosen from W, S, V, E, R, Q, T, C, K, H X5 represents a residue chosen from E, Q, D, H, L.
    [9" id="c-fr-0009]
    9. A variant of a DNA polymerase of the polX family according to claim 8, said variant having at least one substitution of a residue at at least one position Ri, R2 and / or K of the semi-conserved region of sequence SEQ ID No. 4; and / or at least one substitution of a residue at at least one S, RI and / or E position of the semi-conserved region of sequence SEQ ID No. 5; and / or a deletion of the residue at position XI and / or at least one substitution at the R and / or N positions of the semi-conserved region of sequence SEQ ID No. 6.
    [10" id="c-fr-0010]
    10. Variant of a DNA polymerase of the polX family according to one of the preceding claims, said variant comprising a substitution of a residue at at least one position selected from the group consisting of K338, H342, A397, S453, R461, N474, D501, Y502, 1503, R508 and N509, or a functionally equivalent residue, preferably a substitution of a residue at at least one position selected from the group consisting of A397, R461, N474, D501, Y502 and 1503, or a functionally equivalent residue, the positions indicated being determined by alignment with SEQ ID No. 1.
    [11" id="c-fr-0011]
    11. A variant of a DNA polymerase of the polX family according to claim 10, in which the substitutions at positions K338, H342, A397, S453, R461, N474, D501, Y502, 1503, R508 and N509 are selected from the group. consisting of K338A / C / G / S / T / N, H342A / C / G / S / TN, A397R / H / K / D / E, S453A / C / G / S / T, N474S / T / N / Q, D501A / G / X,
    Y502A / G / X, I503A / G / X, R508A / C / G / S / T, N509A / C / G / S / T.
    [12" id="c-fr-0012]
    12. Variant of a DNA polymerase of the polX family according to one of the preceding claims, in which the variant comprises or has a substitution, deletion, combinations of substitutions and / or deletions listed in Table 1, the positions indicated being determined. by alignment with SEQ ID N ° l.
    [13" id="c-fr-0013]
    13. Variant of a DNA polymerase of the polX family according to one of the preceding claims, said variant being a variant of the TdT of sequence SEQ ID No. 1 and further comprising a substitution of the residues between positions C378 to L406 , or the functionally equivalent residues by residues H363 to C390 of the Polp polymerase of sequence SEQ ID No. 2, or the functionally equivalent residues.
    [14" id="c-fr-0014]
    14. Nucleic acid encoding a variant of a DNA polymerase of the polX family according to one of claims 1 to 13.
    [15" id="c-fr-0015]
    15. Cassette for expression of a nucleic acid according to claim 14.
    [16" id="c-fr-0016]
    16. Vector comprising a nucleic acid according to claim 14 or an expression cassette according to claim 15.
    [17" id="c-fr-0017]
    17. Host cell comprising a nucleic acid according to claim 14 or an expression cassette according to claim 15 or a vector according to claim 16.
    5
    [18" id="c-fr-0018]
    18. Use of a nucleic acid according to claim 14, an expression cassette according to claim 15, a vector according to claim 16 or a cell according to claim 17, for producing a variant of a PolX family DNA polymerase according to any one of claims 1-12.
    [19" id="c-fr-0019]
    19. Method for producing a variant of a DNA polymerase of the polX family according to one
    10 any one of claims 1-13, according to which a host cell according to claim 17 is cultured under culture conditions allowing the expression of the nucleic acid coding for said variant, and optionally said variant thus expressed is recovered from the medium of culture or said host cells.
    [20" id="c-fr-0020]
    20. Use of a variant of a DNA polymerase of the polX family according to any one
    15 of claims 1-13, for synthesizing a template strandless nucleic acid molecule, from nucleotides modified into 3′-OH, preferably for synthesizing a DNA strand or an RNA strand.
    [21" id="c-fr-0021]
    21. A method of enzymatic synthesis of a nucleic acid molecule without a template strand, according to which a primer strand is brought into contact with at least one nucleotide, preferably a
    20 nucleotide modified to 3′-OH, in the presence of a variant of a DNA polymerase of the polX family according to any one of claims 1-13.
    [22" id="c-fr-0022]
    22. Kit for the enzymatic synthesis of a template strandless nucleic acid molecule comprising at least one variant of a DNA polymerase of the polX family according to any one of claims 1-13, nucleotides, preferably nucleotides
    [23" id="c-fr-0023]
    25 modified to 3’-OH, and optionally at least one nucleotide primer.
    1/2
    Ml 2 3 4 5 6 7
    BBBBB ·
    类似技术:
    公开号 | 公开日 | 专利标题
    FR3053699A1|2018-01-12|POLYMERASE DNA VARIANTS OF THE POLX FAMILY
    Maskin et al.2007|Dimerization and DNA-binding of ASR1, a small hydrophilic protein abundant in plant tissues suffering from water loss
    CA2768857C|2018-02-20|Porphyranases, and use thereof for hydrolyzing polysaccharides
    JP6745720B2|2020-08-26|Modified KZ144 endolysin sequence
    Zhou et al.2019|Characterization of a group D anti-lipopolysaccharide factor | involved in anti-Vibrio response in Penaeus monodon
    CN110551700A|2019-12-10|ADH protein family mutant and application thereof
    US7238513B2|2007-07-03|Nucleic acid sequences encoding Conus protein disulfide isomerase
    EP1590460A1|2005-11-02|Hyperactive, non-phosphorylated, mutant transposases of mariner mobile genetic elements
    EP2906593B1|2020-03-11|Method for preparing c1q recombinant protein
    EP3455246B1|2021-03-10|Method for the affinity purification of recombinant proteins based on the lectin activity of the crd of a galectin
    WO2017182760A1|2017-10-26|Encapsulin-based nanoparticles
    WO2006008379A1|2006-01-26|Recombinant endofucanase
    FR2841559A1|2004-01-02|MODIFIED RECEPTORS, PREPARATION AND USES
    FR2844806A1|2004-03-26|Expression system for toxic proteins, useful e.g. for identifying antiviral agents, comprises a sequence encoding a protein fused to Asp-Pro for reduction in cytotoxicity
    FR2900407A1|2007-11-02|NOVEL POLYPEPTIDES INDUCING DENDRITIC CELLS AND MEDICAMENTS AND PHARMACEUTICAL COMPOSITIONS CONTAINING SUCH POLYPEPTIDES
    CN105779414B|2020-07-03|Novel lipase
    CN105779415B|2020-07-03|Novel lipase
    EP3068877B1|2021-06-09|Modified kz144 endolysin sequence
    KR20140080281A|2014-06-30|Method for preparing allose by using enzyme producing hyperthermophilic strain
    CN105779416B|2020-07-03|Novel lipase
    EP1138771A1|2001-10-04|Coffee endo-mannanase
    WO2006018512A1|2006-02-23|ISOLATED GENE CODING FOR λ-CARRAGEENASE AND RECOMBINANT λ-CARRAGEENASE OBTAINED WITH SAID GENE
    CA2153162A1|1994-08-18|New polypeptides having serotoninergic receptor activity, nucleic acids coding therefor and uses thereof
    CN113025596A|2021-06-25|Methanol-tolerant lipase
    FR3082208A1|2019-12-13|METHOD OF MODIFYING A TARGET NUCLEIC ACID SEQUENCE OF A HOST CELL
    同族专利:
    公开号 | 公开日
    FR3052462A1|2017-12-15|
    SG11201809961TA|2018-12-28|
    JP2019517799A|2019-06-27|
    SG10202009688QA|2020-11-27|
    CA3024184A1|2017-12-21|
    IL263503D0|2019-02-03|
    WO2017216472A2|2017-12-21|
    WO2017216472A3|2018-03-15|
    EP3469075A2|2019-04-17|
    AU2017286477A1|2018-12-06|
    FR3053699B1|2021-04-02|
    US20200002690A1|2020-01-02|
    CN109477080A|2019-03-15|
    KR20190024883A|2019-03-08|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    WO2016064880A1|2014-10-20|2016-04-28|Molecular Assemblies, Inc.|Modified template-independent enzymes for polydeoxynucleotide systhesis|
    US5004689A|1982-02-22|1991-04-02|Biogen, Massachusetts|DNA sequences, recombinant DNA molecules and processes for producing human gamma interferon-like polypeptides in high yields|
    IL71691A|1984-04-27|1991-04-15|Yeda Res & Dev|Production of interferon-ypsilon|
    US5047335A|1988-12-21|1991-09-10|The Regents Of The University Of Calif.|Process for controlling intracellular glycosylation of proteins|
    BG52073B2|1990-01-24|1996-04-30|Inst Molekuljarna Biolog|Method for the preparation of recombinant human noncystein -interferon, free of n-end methionine|
    US9023633B2|2008-11-03|2015-05-05|Kapa Biosystems|Chimeric DNA polymerases|
    FR3020071B1|2014-04-17|2017-12-22|Dna Script|PROCESS FOR THE SYNTHESIS OF NUCLEIC ACIDS, IN PARTICULAR LARGE NUCLEIC ACIDS, USE OF THE METHOD AND KIT FOR IMPLEMENTING THE METHOD|
    FR3025201B1|2014-09-02|2018-10-12|Dna Script|MODIFIED NUCLEOTIDES FOR THE SYNTHESIS OF NUCLEIC ACIDS, A KIT COMPRISING SUCH NUCLEOTIDES AND THEIR USE FOR GENERATING SYNTHETIC NUCLEIC ACID GENES OR SEQUENCES|CA3087714A1|2018-01-08|2019-07-11|Dna Script|Variants of terminal deoxynucleotidyl transferase and uses thereof|
    AU2020281709A1|2019-05-28|2021-12-16|Centre National De La Recherche Scientifique|Variants of terminal deoxynucleotidyl transferase and uses thereof.|
    US10752887B2|2018-01-08|2020-08-25|Dna Script|Variants of terminal deoxynucleotidyl transferase and uses thereof|
    US20210332351A1|2018-07-23|2021-10-28|Dna Script|Massively Parallel Enzymatic Synthesis of Nucleic Acid Strands|
    SG11202104601PA|2018-11-14|2021-06-29|Dna Script|Terminal deoxynucleotidyl transferase variants and uses thereof|
    WO2020120442A2|2018-12-13|2020-06-18|Dna Script|Direct oligonucleotide synthesis on cells and biomolecules|
    JP2022515912A|2019-01-03|2022-02-22|ディーエヌエー スクリプト|One-pot synthesis of oligonucleotide sets|
    GB201901501D0|2019-02-04|2019-03-27|Nuclera Nucleics Ltd|Modified terminal deoxynucleotidyl transferaseenzymes|
    WO2020165137A1|2019-02-12|2020-08-20|Dna Script|Efficient product cleavage in template-free enzymatic synthesis of polynucleotides.|
    EP3744854A1|2019-05-28|2020-12-02|DNA Script|Variants of terminal deoxynucleotidyl transferase and uses thereof|
    WO2021018919A1|2019-07-30|2021-02-04|Dna Script|Template-free enzymatic synthesis of polynucleotides using poly and poly polymerases|
    WO2021018921A1|2019-08-01|2021-02-04|Dna Script|Increasing long-sequence yields in template-free enzymatic synthesis of polynucleotides.|
    CN110331136B|2019-09-05|2019-12-24|中国科学院天津工业生物技术研究所|Terminal deoxyribonucleoside transferase variant and application thereof|
    WO2021048142A1|2019-09-09|2021-03-18|Dna Script|Template-free enzymatic polynucleotide synthesis using photocleavable linkages|
    WO2021058438A1|2019-09-23|2021-04-01|Dna Script|Increasing long-sequence yields in template-free enzymatic synthesis of polynucleotides|
    WO2021094251A1|2019-11-13|2021-05-20|Dna Script|High efficiency template-free enzymatic synthesis of polynucleotides|
    WO2021116270A1|2019-12-12|2021-06-17|Dna Script|Chimeric terminal deoxynucleotidyl transferases for template-free enzymatic synthesis of polynucleotides|
    WO2021122539A1|2019-12-16|2021-06-24|Dna Script|Template-free enzymatic polynucleotide synthesis using dismutationless terminal deoxynucleotidyl transferase variants|
    WO2021170524A1|2020-02-25|2021-09-02|Dna Script|Method and apparatus for enzymatic synthesis of polynucleotides|
    WO2021213903A1|2020-04-20|2021-10-28|Dna Script|Terminal deoxynucleotidyl transferase variants and uses thereof|
    WO2021250265A2|2020-06-12|2021-12-16|Synhelix|Ab-initio, template-independent synthesis of nucleic acids using thermostable enzymes|
    WO2021254934A1|2020-06-16|2021-12-23|Dna Script|Systems, apparatus and kits for enzymatic polynucleotide synthesis|
    WO2022013094A1|2020-07-15|2022-01-20|Dna Script|Massively parallel enzymatic synthesis of polynucleotides|
    WO2022029427A1|2020-08-04|2022-02-10|Nuclera Nucleics Ltd|MODIFIED TERMINAL DEOXYNUCLEOTIDYL TRANSFERASEENZYMES|
    GB2598152A|2020-08-21|2022-02-23|Nuclera Nucleics Ltd|Modified terminal deoxynucleotidyl transferaseenzymes|
    CN112322715A|2020-11-17|2021-02-05|清华大学|Nucleic acid sequencing method|
    法律状态:
    2017-07-20| PLFP| Fee payment|Year of fee payment: 2 |
    2018-01-12| PLSC| Search report ready|Effective date: 20180112 |
    2018-06-18| PLFP| Fee payment|Year of fee payment: 3 |
    2020-04-30| PLFP| Fee payment|Year of fee payment: 5 |
    2021-06-22| PLFP| Fee payment|Year of fee payment: 6 |
    优先权:
    申请号 | 申请日 | 专利标题
    FR1655475|2016-06-14|
    FR1655475A|FR3052462A1|2016-06-14|2016-06-14|POLYMERASE DNA VARIANTS OF THE POLX FAMILY|
    FR1756408A|FR3053699B1|2016-06-14|2017-07-07|VARIANTS OF A POLYMERASE DNA OF THE POLX FAMILY|FR1756408A| FR3053699B1|2016-06-14|2017-07-07|VARIANTS OF A POLYMERASE DNA OF THE POLX FAMILY|
    [返回顶部]